Review



ecop15i recognition sequence  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    New England Biolabs ecop15i recognition sequence
    Ecop15i Recognition Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecop15i+recognition+sequence/EcoP15I/pm41692170-311-13-62
    Average 95 stars, based on 97 article reviews
    ecop15i recognition sequence - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Cross-organ communication based on non-coding RNA networks leads to cognitive dysfunction in mice.
    Article Snippet: .. One μl (10 μM) of the RNA adapter (5′- ACACUCUUUCCCUACACGACGCUCUUCCGAUCUCAGCAG -3′′) containing an EcoP15I recognition sequence at the 3′ end was added to the purified RNA solution and ligated to the 5′ end of non-capped RNAs in the presence of 2 μl T4 RNA ligase buffer, 2 μl 10 mM ATP and 1 μl T4 RNA ligase 1 (ssRNA Ligase) (5 units/μl) (NEB, Ipswich, MA, USA) in a 20 μl reaction. .. After incubation for 60 min at 37 ◦ C the RNA was purified using an RNA Clean & Concentrator-5 spin column (Zymo Research, Irvine, CA, USA) as recommended by the manufacturer.

    Purification:

    Article Title: Cross-organ communication based on non-coding RNA networks leads to cognitive dysfunction in mice.
    Article Snippet: .. One μl (10 μM) of the RNA adapter (5′- ACACUCUUUCCCUACACGACGCUCUUCCGAUCUCAGCAG -3′′) containing an EcoP15I recognition sequence at the 3′ end was added to the purified RNA solution and ligated to the 5′ end of non-capped RNAs in the presence of 2 μl T4 RNA ligase buffer, 2 μl 10 mM ATP and 1 μl T4 RNA ligase 1 (ssRNA Ligase) (5 units/μl) (NEB, Ipswich, MA, USA) in a 20 μl reaction. .. After incubation for 60 min at 37 ◦ C the RNA was purified using an RNA Clean & Concentrator-5 spin column (Zymo Research, Irvine, CA, USA) as recommended by the manufacturer.



    Similar Products

    ecop15i recognition sequence  (New England Biolabs)
    95
    New England Biolabs ecop15i recognition sequence
    Ecop15i Recognition Sequence, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/ecop15i+recognition+sequence/EcoP15I/pm41692170-311-13-62
    Average 95 stars, based on 1 article reviews
    ecop15i recognition sequence - by Bioz Stars, 2026-10
    95/100 stars
    		  Buy from Supplier

    Image Search Results